Arthritis Research: Methods and Protocols by Shunichi Shiozawa

By Shunichi Shiozawa

Arthritis study: tools and Protocols, moment variation expands upon thefirst variation to provide new and present concepts for the learn of arthritis and similar stipulations. A compendium of leaders within the box give a contribution chapters that disguise functional learn tools comparable to the intravital multiphoton microscopy procedure, thoughts for comparing exhausted CD8 T phone and for learning nucleic acid sensors and their results, tools for in vivo tetracycline-controlled transgenic mice and T telephone receptor transgenic mice, protocols to discover V(D)J recombination items and microRNA, and the strategy to make bleomycin-induced dermal fibrosis. Written within the winning Methods in Molecular Biology sequence structure, chapters contain introductions to their respective themes, lists of the mandatory fabrics and reagents, step by step, quite simply reproducible protocols, and notes on troubleshooting and warding off recognized pitfalls.

Authoritative and simply obtainable, Arthritis learn: equipment and Protocols, moment variation will serve either execs and newbies with state of the art strategies touching on this attention-grabbing learn field.

Show description

Read or Download Arthritis Research: Methods and Protocols PDF

Similar rheumatology books

Common Spinal Disorders Explained

If it have been a affliction, again ache will be known as a virulent disease. a minimum of five million humans will seek advice their GPs approximately again discomfort this 12 months. the full expenditures to the united kingdom are envisioned at #12 billion/year. This publication information the typical stipulations which reason again ache and descriptions a technique for the analysis, research and therapy of the stipulations.

Imaging of Arthritis and Metabolic Bone Disease: Expert Consult - Online and Print

Get cutting-edge assurance of the entire diversity of imaging options on hand to aid within the analysis and healing administration of rheumatic illnesses. Written through stated specialists in musculoskeletal imaging, this richly illustrated, full-color textual content offers the most recent diagnostic and sickness tracking modalities - MRI, CT, ultrasonography, nuclear drugs, DXA - in addition to interventional techniques.

Problem Solving in Rheumatology

"Problem fixing in Rheumatology" joins this transforming into sequence. Co-authored by way of Lee Kennedy who wrote "Problem fixing in Diabetes", this may be a massive contribution in a huge and fast paced medical region. each one scientific case will spotlight how fresh advancements in medical and pharmaceutical study have had key effect at the perform of rheumatology.

Tendon Regeneration. Understanding Tissue Physiology and Development to Engineer Functional Substitutes

Tendon Regeneration: realizing Tissue body structure and improvement to Engineer sensible Substitutes is the 1st booklet to spotlight the multi-disciplinary nature of this really good box and the significance of collaboration among clinical and engineering laboratories within the improvement of tissue-oriented items for tissue engineering and regenerative medication (TERM) recommendations.

Extra resources for Arthritis Research: Methods and Protocols

Sample text

J Interferon Cytokine Res 31:27–31 13. Yoneyama M, Fujita T (2009) RNA recognition and signal transduction by RIG-I-like receptors. Immunol Rev 227:54–65 14. Rehwinkel J, Reis e Sousa C (2010) RIGorous detection: exposing virus through RNA sensing. Science 327:284–286 15. Yoneyama M, Kikuchi M, Natsukawa T, Shinobu N, Imaizumi T, Miyagishi M et al (2004) The RNA helicase RIG-I has an 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. essential function in double-stranded RNAinduced innate antiviral responses.

Human IL-1β: IL-1β, Human, ELISA Kit (R&D Systems). 3 Methods Carry out all procedures at room temperature unless otherwise specified. 1 Extracellular RNA/DNA Stimulation 1. 7 cells) or 5–10 × 105 cells (primary CD14+ monocytes) in 12-well plate in 500 μl of culture medium with serum but without antibiotics and grown overnight. 2. 5–50 μg of RNA/DNA ligands are suspended in 500 μl of culture medium (see Note 5). IFNA1 IFNA4 IFNB1 CXCL10 TNF IL6 OAS2 ISG15 ACTB GAPDH Ifna4 Ifnb1 Cxcl10 Tnf Il6 Oas1 Isg15 Actb Gapdh Human Murine TGATGAGCTACTACTGGTCAGC GAGCTCCAAGAAAGGACGAAC CCAAGTGCTGCCGTCATTTTC CCCTCACACTCAGATCATCTTCT TAGTCCTTCCTACCCCAATTTCC TGTCCTGGGTCATGTTAATAC AGCAATGGCCTGGGACCTAAA GCTCCCCGGGCTGTATTCC AGGTCGGTGTGAACGGATTTG GCCTCGCCCTTTGCTTTACT ACCTGGTTCAACATGGAAATG ATGACCAACAAGTGTCTCCTCC GTGGCATTCAAGGAGTACCTC ATGAGCACTGAAAGCATGATCC AACCTGAACCTTCCAAAGATGG AACTGCTTCCGACAATCAAC GAGAGGCAGCGAACTCATCT CATGTACGTTGCTATCCAGGC CATGAGAAGTATGACAACAGCCT Gene symbol Forward primer (5′–3′) Species GATCTCTTAGCACAAGGATGGC GGCAGTGTAACTCTTCTGCAT GGCTCGCAGGGATGATTTCAA GCTACGACGTGGGCTACAG TTGGTCCTTAGCCACTCCTTC CCGTGAAGCAGGTAGAGA AGCCGGCACACCAATCTT CTCTCTTGCTCTGGGCCTCGT TGTAGACCATGTAGTTGAGGTCA CTGTGGGTCTCAGGGAGATCA ACCAAGCTTCTTCACACTGCT GCTCATGGAAAGAGCTGTAGTG GCCTTCGATTCTGGATTCAGACA GAGGGCTGATTAGAGAGAGGTC TCTGGCTTGTTCCTCACTACT CCTCCTTCTCCCTCCAAAA CTTCAGCTCTGACACCGACA CTCCTTAATGTCACGCACGAT AGTCCTTCCACGATACCAAAGT Reverse primer (5′–3′) Table 2 Oligonucleotides used for the amplification of human and murine genes J Immunol 2010, 185:6146–6156 J Immunol 2010, 185:6146–6156 Nucl Acid Res 2012, 40:D1144–D1149 Infect Immun 2005, 73:3990–3998 J Immunol 2008, 181:2723–2731 J Immunol 2008, 180:2474–2485 J Virol 2006, 80:4501–4509 J Virol 2006, 80:4501–4509 J Immunol 2010, 185:6146–6156 Nat Immunol 2011, 12:37–44 Nat Immunol 2011, 12:37–44 Nat Immunol 2011, 12:37–44 Nat Immunol 2011, 12:37–44 Nat Immunol 2011, 12:37–44 Nat Immunol 2011, 12:37–44 J Immunol 2003, 170:749–756 Breast Cancer Res 2008, 10:R58 Nat Immunol 2011, 12:37–44 Nat Immunol 2011, 12:37–44 References Characterization of Innate Immune Signalings Stimulated by Ligands for Pattern… 27 28 Takeshi Kameyama and Akinori Takaoka 3.

Blood 102:3363–3370 6. Kharas MG, Yusuf I, Scarfone VM, Yang VW, Segre JA, Huettner CS et al (2007) KLF4 suppresses transformation of pre-B cells by ABL oncogenes. Blood 109:747–755 7. Bockamp E, Antunes C, Maringer M, Heck R, Presser K, Beilke S et al (2006) Tetracyclinecontrolled transgenic targeting from the SCL locus directs conditional expression to erythrocytes, megakaryocytes, granulocytes, and c-kitexpressing lineage-negative hematopoietic cells. Blood 108:1533–1541 8. Huai J, Firat E, Niedermann G (2007) Inducible gene expression with the Tet-on system in CD4+ T cells and thymocytes of mice.

Download PDF sample

Rated 4.09 of 5 – based on 31 votes